Detail of EST/Unigene TCSL77712 |
Acc. | TCSL77712 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Vacuolar cation/proton exchanger 3 OS=Arabidopsis thaliana E-value=7e-70; Vacuolar cation/proton exchanger 1 OS=Arabidopsis thaliana E-value=4e-66; Vacuolar cation/proton exchanger 1a OS=Oryza sativa subsp. japonica E-value=5e-60; Vacuolar cation/proton exchanger 1b OS=Oryza sativa subsp. japonica E-value=1e-55; Vacuolar cation/proton exchanger 4 OS=Arabidopsis thaliana E-value=3e-46; |
Length | 921 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_MicroLEAF3 (28 ESTs); SL_SHOOT_4WEEK (5 ESTs); SL_TAMU (2 ESTs); SL_SUS_LEAF (2 ESTs); SL_flowerbuds4 (2 ESTs); SL_FLOWERBUDS3 (2 ESTs); SL_MicroFRUIT2 (1 ESTs); SL_CELL_BTI (1 ESTs); LIBEST_024426 (1 ESTs); SL_flower_buds4 (1 ESTs); SRR015435 (1 ESTs); SL_flower_anthesis (1 ESTs); SL_FLOWERBUDS (1 ESTs); |
Sequence | GAGATGAGAGTTATCTCAATATAAAACCAAAATAAGTTATTTTCCAAAGAAAAAGACAAA |
EST members of Unigene | AW737408 SRR015435.249936 DB707090 AI780101 DB684121 DB689279 DB699524 DB687281 DB708266 DB704854 DB684233 DB685654 BW689874 DB702826 DB688266 DB684868 BG129224 DB683210 DB687648 DB691253 DB697999 AI771453 DB685601 BI928634 AI899610 DB688070 DB691206 DB698739 DB699439 BI935430 AW929865 BE463275 DB682802 DB684850 DB704327 BG124358 AI484823 DB704111 DB706945 BG130283 AW934664 DB679513 BG125468 AW934474 BG126449 FS202182 DB683154 AW093618 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 2.A.1 Major facilitator superfamily MFS; 2.A.19 Ca2+:cation antiporter CaCA |
Probeset |
|
Corresponding NCBI Gene | 824349 |
Trichome-related Gene from Literature | 824349 |