| Detail of EST/Unigene TCSL77782 |
| Acc. | TCSL77782 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | High-affinity nitrate transporter 3.2 OS=Arabidopsis thaliana E-value=5e-38; High-affinity nitrate transporter 3.1 OS=Arabidopsis thaliana E-value=2e-37; |
| Length | 915 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435 (20 ESTs); SL_radicle (4 ESTs); SL_ROOT_pre-anthesis (2 ESTs); SRR015436 (2 ESTs); LIBEST_024426 (1 ESTs); SL_ROOT_pre-anthesis2 (1 ESTs); SL_MicroLEAF3 (1 ESTs); |
| Sequence | GGCCATTACGGGGGATTCCAATTTTCATTCTCTAATTAGTATATATATACTACCAAGAAG |
| EST members of Unigene | BE450048 BF114130 SRR015435.94275 SRR015435.238306 SRR015435.46958 SRR015435.185044 SRR015435.286175 SRR015435.55721 SRR015435.57473 AW625429 SRR015436.151818 FS203615 AW625584 SRR015435.172627 SRR015435.329950 AW625477 DB684730 SRR015435.257183 SRR015436.261987 SRR015435.8378 BF113833 SRR015435.9935 SRR015435.20053 SRR015435.157902 SRR015435.49991 SRR015435.42850 AW624917 SRR015435.52350 SRR015435.93231 SRR015435.167822 SRR015435.221337 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 8.A.2 Secretin auxiliary lipoprotein SAL |
| Probeset |
|
| Corresponding NCBI Gene | 835085 |
| Trichome-related Gene from Literature | 835085 |