| Detail of EST/Unigene TCSL77894 |
| Acc. | TCSL77894 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA synthase 10 OS=Arabidopsis thaliana E-value=1e-69; 3-ketoacyl-CoA synthase 4 OS=Arabidopsis thaliana E-value=2e-62; 3-ketoacyl-CoA synthase 6 OS=Arabidopsis thaliana E-value=4e-61; 3-ketoacyl-CoA synthase 9 OS=Arabidopsis thaliana E-value=1e-60; 3-ketoacyl-CoA synthase 17 OS=Arabidopsis thaliana E-value=1e-58; |
| Length | 904 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015436 (27 ESTs); SRR015435 (13 ESTs); SL_MicroLEAF3 (2 ESTs); SL_FLOWER_DEV (2 ESTs); LIBEST_025267 (1 ESTs); |
| Sequence | TGGATGCTTCAAATTCCTGGCGCAACAAGTTACAAGGGGCTAAAGATAAGCAAAGATTTA |
| EST members of Unigene | SRR015436.265597 SRR015435.322611 SRR015436.123535 SRR015436.44431 SRR015435.346824 SRR015436.239987 DB708617 SRR015435.109362 SRR015435.273562 SRR015436.54455 SRR015436.17542 SRR015436.233559 SRR015436.69277 BG626513 SRR015436.312445 SRR015436.117478 DB700000 SRR015436.117888 SRR015436.50236 SRR015436.106407 SRR015435.216979 SRR015436.275454 SRR015436.272876 SRR015436.145603 SRR015436.41642 SRR015436.198435 SRR015435.252734 SRR015435.268816 SRR015435.43944 SRR015436.78103 SRR015436.153900 SRR015435.274043 SRR015436.37609 SRR015436.132826 BG626648 SRR015435.171322 GT167892 SRR015435.58947 SRR015436.253583 SRR015435.249877 SRR015436.60740 SRR015436.140238 SRR015435.356683 SRR015436.223553 SRR015436.165528 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817165 |
| Trichome-related Gene from Literature | 817165 |