| Detail of EST/Unigene TCSL78148 |
| Acc. | TCSL78148 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase PARB OS=Nicotiana tabacum E-value=0; Glutathione S-transferase APIC OS=Nicotiana tabacum E-value=0; Glutathione S-transferase OS=Hyoscyamus muticus E-value=4e-80; Glutathione S-transferase F8, chloroplastic OS=Arabidopsis thaliana E-value=4e-63; Glutathione S-transferase OS=Silene vulgaris E-value=5e-61; |
| Length | 877 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | LIBEST_024426 (9 ESTs); SL_ROOT_pre-anthesis (2 ESTs); SL_SHOOT_8WEEK (1 ESTs); SL_MicroFRUIT (1 ESTs); SL_FRUIT (1 ESTs); |
| Sequence | ATCTATCATAATCCTAATTTATTATTCTTGAAATAATGGCAATCAAAGTCCATGGTATCC |
| EST members of Unigene | FS189800 AI482844 BE432843 BF114315 DB719365 FS194126 BF114155 FS187904 FS180487 FS205754 FS184268 FS186287 FS200439 FS180719 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819386 |
| Trichome-related Gene from Literature | 819386 |