| Detail of EST/Unigene TCSL79094 |
| Acc. | TCSL79094 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Actin-depolymerizing factor 2 OS=Petunia hybrida E-value=3e-71; Actin-depolymerizing factor 1 OS=Petunia hybrida E-value=4e-67; Actin-depolymerizing factor 1 OS=Arabidopsis thaliana E-value=4e-65; Actin-depolymerizing factor 4 OS=Arabidopsis thaliana E-value=2e-64; Actin-depolymerizing factor 7 OS=Oryza sativa subsp. japonica E-value=2e-63; |
| Length | 802 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015436 (16 ESTs); SRR015435 (7 ESTs); SL_maturing_fruit (3 ESTs); LIBEST_024426 (2 ESTs); SL_CELL_BTI (1 ESTs); SL_FLOWER (1 ESTs); SL_CROWNGALL (1 ESTs); SL_ROOT (1 ESTs); SL_SHOOT_4WEEK (1 ESTs); SL_Lyc_leaf (1 ESTs); SL_FLOWER_DEV (1 ESTs); SL_FRUIT (1 ESTs); |
| Sequence | GGCCATTACGGCCGGGGGGTCTCATTTTCCCCCAAATACCAATTTTATCGGAGCCCTAAA |
| EST members of Unigene | SRR015436.145999 SRR015435.328171 SRR015436.166793 SRR015436.223101 BG128360 SRR015436.97539 SRR015435.265791 AW096811 SRR015435.206615 BE436557 BP890366 AW220154 SRR015435.316286 BP890993 SRR015436.324084 SRR015435.269783 SRR015435.65877 SRR015436.121529 BI932684 SRR015436.144739 FS180876 FS199966 BG629476 BG135319 SRR015435.83289 SRR015436.335170 SRR015436.274668 SRR015436.122754 SRR015436.144450 SRR015436.93720 SRR015436.154860 SRR015436.85667 BP890653 BP903787 SRR015436.116379 SRR015436.257159 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 823744 |
| Trichome-related Gene from Literature | 823744 |