| Detail of EST/Unigene TCSL79746 |
| Acc. | TCSL79746 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 40S ribosomal protein S13 OS=Glycine max E-value=6e-78; 40S ribosomal protein S13-2 OS=Arabidopsis thaliana E-value=1e-76; 40S ribosomal protein S13-1 OS=Arabidopsis thaliana E-value=2e-76; 40S ribosomal protein S13 OS=Pisum sativum E-value=2e-74; 40S ribosomal protein S13-2 OS=Oryza sativa subsp. japonica E-value=2e-71; |
| Length | 762 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015436 (9 ESTs); SRR015435 (2 ESTs); SL_cTOS (2 ESTs); SL_MicroLEAF3 (2 ESTs); SL_RES (2 ESTs); SL_MicroFRUIT (1 ESTs); SL_CELL_BTI (1 ESTs); SL_FLOWER (1 ESTs); SL_SUS_LEAF (1 ESTs); SL_SHOOT_4WEEK (1 ESTs); LIBEST_024426 (1 ESTs); SL_MicroFRUIT2 (1 ESTs); |
| Sequence | GAGGGTTTCGCTGCTGTAGCCGCCGCACATCGGAGCACCGCCGTCAGCCGCCATGGGTCG |
| EST members of Unigene | DB685807 BI209111 DB702664 FS204130 AI778535 DB719426 SRR015436.193235 SRR015436.72551 SRR015436.10181 SRR015436.282371 AI775149 SRR015436.97562 SRR015435.122891 AI775900 SRR015436.65523 SRR015436.34323 SRR015435.137948 BG130315 SRR015436.100292 BI211103 BI933050 BW692355 AW093972 SRR015436.43711 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02953 small subunit ribosomal protein S13e |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828167 |
| Trichome-related Gene from Literature | 828167 |