| Detail of EST/Unigene TCSL79768 |
| Acc. | TCSL79768 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 40S ribosomal protein S13 OS=Glycine max E-value=1e-78; 40S ribosomal protein S13-2 OS=Arabidopsis thaliana E-value=5e-76; 40S ribosomal protein S13-1 OS=Arabidopsis thaliana E-value=9e-76; 40S ribosomal protein S13 OS=Pisum sativum E-value=4e-75; 40S ribosomal protein S13-2 OS=Oryza sativa subsp. japonica E-value=1e-70; |
| Length | 761 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015436 (18 ESTs); SRR015435 (12 ESTs); SL_Lyc_leaf (2 ESTs); SL_CROWNGALL (1 ESTs); SL_ROOT (1 ESTs); LIBEST_024426 (1 ESTs); SL_cTOS (1 ESTs); SL_FLOWERBUDS3 (1 ESTs); SL_MicroLEAF3 (1 ESTs); |
| Sequence | GGTCCATTACGGCCGGGGGTCCATTCTAGGGTTTCCTTCTTCAGAGCTAACCGGACAGCA |
| EST members of Unigene | SRR015435.121594 SRR015436.70308 SRR015435.293328 SRR015435.10619 BE463357 AW621681 SRR015435.257679 BG133796 SRR015435.39593 SRR015436.170169 SRR015436.82864 SRR015436.116399 SRR015436.28252 SRR015435.135561 SRR015435.126463 SRR015435.120447 SRR015436.91982 SRR015436.309150 SRR015436.243516 BI207011 FS201274 SRR015436.147207 SRR015436.196215 DB698539 BP903732 SRR015435.114873 SRR015435.34989 SRR015435.346512 SRR015436.133637 SRR015436.66684 SRR015436.315193 SRR015436.194915 SRR015436.124942 SRR015436.321118 SRR015435.298127 SRR015436.108006 BP898463 SRR015436.102217 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02953 small subunit ribosomal protein S13e |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828167 |
| Trichome-related Gene from Literature | 828167 |