| Detail of EST/Unigene TCSL79988 |
| Acc. | TCSL79988 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 40S ribosomal protein S13 OS=Glycine max E-value=1e-78; 40S ribosomal protein S13-2 OS=Arabidopsis thaliana E-value=5e-76; 40S ribosomal protein S13-1 OS=Arabidopsis thaliana E-value=9e-76; 40S ribosomal protein S13 OS=Pisum sativum E-value=4e-75; 40S ribosomal protein S13-2 OS=Oryza sativa subsp. japonica E-value=1e-70; |
| Length | 747 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015436 (18 ESTs); SRR015435 (4 ESTs); SL_MicroLEAF3 (1 ESTs); SL_RES (1 ESTs); SL_DROOT (1 ESTs); SL_SUS_LEAF (1 ESTs); LIBEST_024426 (1 ESTs); LIBEST_024457 (1 ESTs); LIBEST_024458 (1 ESTs); LIBEST_024456 (1 ESTs); SL_maturing_fruit (1 ESTs); |
| Sequence | GGCCATTACGGCCGGGGGTCATTTTAGAGATTTCGCTGCTACTTATAGCCAATCGGAGCG |
| EST members of Unigene | SRR015436.112173 SRR015436.128988 AI782615 SRR015436.232226 SRR015435.30841 FS204784 SRR015435.239307 SRR015436.197031 SRR015436.151214 SRR015436.253038 AI774763 SRR015436.202384 SRR015436.24067 GO372244 SRR015436.335080 BP889545 DB691745 SRR015436.313068 SRR015436.314917 SRR015436.91392 SRR015436.241442 SRR015436.223951 GO375233 EG553945 SRR015436.323310 SRR015435.71182 SRR015435.173684 SRR015436.268776 SRR015436.62942 SRR015436.216017 GO376229 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02953 small subunit ribosomal protein S13e |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828167 |
| Trichome-related Gene from Literature | 828167 |