Detail of EST/Unigene TCSL80122 |
Acc. | TCSL80122 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA thiolase 2, peroxisomal OS=Arabidopsis thaliana E-value=3e-82; 3-ketoacyl-CoA thiolase 1, peroxisomal OS=Arabidopsis thaliana E-value=2e-75; 3-ketoacyl-CoA thiolase 5, peroxisomal OS=Arabidopsis thaliana E-value=6e-73; 3-ketoacyl-CoA thiolase, peroxisomal OS=Homo sapiens E-value=9e-41; 3-ketoacyl-CoA thiolase B, peroxisomal OS=Mus musculus E-value=1e-39; |
Length | 738 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_CELL_BTI (4 ESTs); SL_MicroLEAF3 (2 ESTs); LIBEST_024426 (1 ESTs); SL_Lyc_leaf (1 ESTs); SL_TAMU_CALLUS (1 ESTs); SL_flower_buds3 (1 ESTs); SL_FLOWERBUDS (1 ESTs); SL_MicroFRUIT (1 ESTs); SL_FLOWER (1 ESTs); |
Sequence | ACAACCCCTTTTTCATTTGTGCAGGTCTCAAAGGGAAAAAAGAGGAATTGATCATGGAGA |
EST members of Unigene | AW092555 DB721870 DB692088 AW096548 BI930800 BI923831 BE354205 BP899232 AW037869 AW443065 FS206161 AW216906 DB703320 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00362 Benzoate degradation via hydroxylation > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K07513 acetyl-CoA acyltransferase 1; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K07513 acetyl-CoA acyltransferase 1 |
EC | 2.3.1.16 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817876 |
Trichome-related Gene from Literature | 817876 |