| Detail of EST/Unigene TCSL80228 |
| Acc. | TCSL80228 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Proteasome subunit alpha type-5 OS=Glycine max E-value=0; Proteasome subunit alpha type-5 OS=Oryza sativa subsp. japonica E-value=0; Proteasome subunit alpha type-5-B OS=Arabidopsis thaliana E-value=0; Proteasome subunit alpha type-5-A OS=Arabidopsis thaliana E-value=0; Probable proteasome subunit alpha type-5 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=3e-83; |
| Length | 737 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435 (17 ESTs); SRR015436 (6 ESTs); LIBEST_024426 (2 ESTs); SL_germ_seedlings_TAMU (1 ESTs); SL_flower_buds8 (1 ESTs); SL_MicroLEAF3 (1 ESTs); SL_SHOOT_8WEEK (1 ESTs); SL_SHOOT_4WEEK (1 ESTs); |
| Sequence | GGCCATTACGGCCGGGGGAATCTTCAGTTCAAACAAAATCTGAACAAAGGGTTTTTGGAT |
| EST members of Unigene | FS188228 DB708581 AI483024 SRR015435.88668 SRR015435.243923 SRR015435.72564 SRR015435.308102 SRR015436.262367 SRR015436.336683 AW623343 SRR015435.330406 SRR015436.83952 SRR015435.237384 SRR015435.116414 SRR015435.115946 FS199494 SRR015435.264158 SRR015435.361727 SRR015435.19075 SRR015435.151498 SRR015435.54434 SRR015435.172462 SRR015436.274078 SRR015435.347332 SRR015436.56584 SRR015435.28449 SRR015436.147235 BG130501 SRR015435.160250 AW650755 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko03050 Proteasome > K02729 20S proteasome subunit alpha 5 |
| EC | 3.4.25.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820649 |
| Trichome-related Gene from Literature | 820649 |