| Detail of EST/Unigene TCSL84948 |
| Acc. | TCSL84948 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=5e-23; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=5e-23; Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=5e-23; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=5e-23; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=5e-23; |
| Length | 139 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435 (11 ESTs); SRR015436 (1 ESTs); |
| Sequence | TAGCCCATGGTATGGTCCTGACCGTGTTAAGTACTTGGGCCCATTCTCTGGTGAATCACC |
| EST members of Unigene | SRR015435.314659 SRR015435.264677 SRR015435.162887 SRR015435.293963 SRR015435.268014 SRR015435.12730 SRR015435.196495 SRR015435.45552 SRR015435.254909 SRR015435.277942 SRR015435.256616 SRR015436.291064 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |