Detail of EST/Unigene X74905 |
Acc. | X74905 |
Internal Acc. | |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase, acidic isoform PR-Q' OS=Nicotiana tabacum E-value=0; Glucan endo-1,3-beta-glucosidase, basic isoform OS=Prunus persica E-value=0; Glucan endo-1,3-beta-glucosidase OS=Glycine max E-value=0; Lichenase OS=Nicotiana plumbaginifolia E-value=0; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Hevea brasiliensis E-value=4e-99; |
Length | 1200 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_CDS (1 ESTs); |
Sequence | TTTTTCCCAAATGGCTAGCAAACTATCAAATTTCAATTTTTTCACTTTGATTCTCTATGG |
EST members of Unigene | X74905 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824893 |
Trichome-related Gene from Literature | 824893 |