| Detail of Probeset Mtr.10412.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.10412.1.S1_at |
| Species | Medicago truncatula |
| Annotation | TC106703 /FEA=mRNA /DEF=similar to UP|Q7Y1T5 (Q7Y1T5) Oxygen-evolving enhancer protein 3, partial (91%) |
| Mapped public sequence ID | TC106703 |
| Gene Ontology | GO:0004565 GO:0005515 GO:0005990 |
| KEGG | K08901 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40237 TCMT40376 BQ151519 GE343423 |
| Target sequence | gcaagagaccttaagctaccattgaaagaaaggttctaccttcaaccattgacaccaact |