| Detail of EST/Unigene GE343423 |
| Acc. | GE343423 |
| Internal Acc. | MEUA111TF |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 3-2, chloroplastic OS=Arabidopsis thaliana E-value=3e-43; Oxygen-evolving enhancer protein 3-1, chloroplastic OS=Arabidopsis thaliana E-value=2e-40; Oxygen-evolving enhancer protein 3, chloroplastic OS=Spinacia oleracea E-value=6e-39; Oxygen-evolving enhancer protein 3, chloroplastic OS=Onobrychis viciifolia E-value=4e-35; Oxygen-evolving enhancer protein 3-1, chloroplastic OS=Zea mays E-value=8e-33; |
| Length | 612 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2 (1 ESTs); |
| Sequence | TGGTTGCTTACGTGGTTCATCATCTCAAGCTGTGATGGAAGGAAGTCTTCAACTGAGTGG |
| EST members of Unigene | GE343423 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.10412.1.S1_at
|
| Corresponding NCBI Gene | 825866 |
| Trichome-related Gene from Literature | N/A |