Detail of EST/Unigene GE343423 |
Acc. | GE343423 |
Internal Acc. | MEUA111TF |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 3-2, chloroplastic OS=Arabidopsis thaliana E-value=3e-43; Oxygen-evolving enhancer protein 3-1, chloroplastic OS=Arabidopsis thaliana E-value=2e-40; Oxygen-evolving enhancer protein 3, chloroplastic OS=Spinacia oleracea E-value=6e-39; Oxygen-evolving enhancer protein 3, chloroplastic OS=Onobrychis viciifolia E-value=4e-35; Oxygen-evolving enhancer protein 3-1, chloroplastic OS=Zea mays E-value=8e-33; |
Length | 612 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2 (1 ESTs); |
Sequence | TGGTTGCTTACGTGGTTCATCATCTCAAGCTGTGATGGAAGGAAGTCTTCAACTGAGTGG |
EST members of Unigene | GE343423 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.10412.1.S1_at
|
Corresponding NCBI Gene | 825866 |
Trichome-related Gene from Literature | N/A |