Detail of Probeset Mtr.12560.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.12560.1.S1_at
Species Medicago truncatula
Annotation TC95232 /FEA=mRNA /DEF=similar to UP|GTX6_SOYBN (P32110) Probable glutathione S-transferase (Heat shock protein 26A) (G2-4) , complete
Mapped public sequence ID TC95232
Gene Ontology GO:0004364 GO:0005515 GO:0006749 GO:0009636 GO:0042802
KEGG K00799
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database TCMT43587  
Target sequence gatatatgcgacctatgatttctcattgtttaagaagtctagggtt