| Detail of EST/Unigene TCMT43587 |
| Acc. | TCMT43587 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase OS=Glycine max E-value=9e-82; Glutathione S-transferase U8 OS=Arabidopsis thaliana E-value=1e-53; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=2e-49; Glutathione S-transferase U7 OS=Arabidopsis thaliana E-value=8e-49; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=1e-48; |
| Length | 928 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA (4 ESTs); MT_JCVI-MT2 (2 ESTs); MT_ECELL (2 ESTs); MT_DSIL (2 ESTs); MT_Shoots (1 ESTs); MTAMP (1 ESTs); MT_Drought (1 ESTs); |
| Sequence | GGATATATCAATAAGCCAAAAACAGTTGTTTGATTAAGAATTGAAGCGCTAAGATGGCAT |
| EST members of Unigene | CX526913 BF647746 BF645184 AJ504357 BG604191 BF520101 CB893386 BG647855 BG647364 BG646616 BF635123 GE351912 GE347524 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00643 Styrene degradation > K01800 maleylacetoacetate isomerase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K01800 maleylacetoacetate isomerase |
| EC | 2.5.1.18 5.2.1.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.12559.1.S1_s_at, Mtr.12560.1.S1_at
|
| Corresponding NCBI Gene | 820083 |
| Trichome-related Gene from Literature | N/A |