| Detail of Probeset Mtr.14054.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.14054.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
GAP|atpF_75435_75602 /FEA=mRNA /DEF=from 75435 to 75602 (on reverse strand) |
| Mapped public sequence ID |
GAP|atpF_75435_75602 |
| Gene Ontology |
GO:0045260 GO:0003735 GO:0005515 GO:0006412 GO:0022627 |
| KEGG |
K02108 K02109 K02967 |
| Transporter |
3.A.2 3.A.2.1.1 3.A.2.1.2 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT41194 |
| Target sequence |
ttcttttctttgcttcatttactggccatccgccggaagtttcgggtttgataccgatat
tttagcaacaaatctaataaatctaagtgtagtgctaggtgtattaattttttttggaaa
gggagtgtgtgcgagttgtttatttc |
