Detail of EST/Unigene TCMT41194 |
Acc. | TCMT41194 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase subunit a, chloroplastic OS=Pisum sativum E-value=0; 30S ribosomal protein S2, chloroplastic OS=Lotus japonicus E-value=0; 30S ribosomal protein S2, chloroplastic OS=Pisum sativum E-value=0; ATP synthase subunit a, chloroplastic OS=Cicer arietinum E-value=0; 30S ribosomal protein S2, chloroplastic OS=Eucalyptus globulus subsp. globulus E-value=0; |
Length | 3842 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF (63 ESTs); MT_JCVI-MT2 (12 ESTs); MT_DFLOWER (10 ESTs); MT_Shoots (6 ESTs); MT_GESD (6 ESTs); MT_TRI (5 ESTs); MT_INSECT (4 ESTs); MT_GSEED (3 ESTs); MTGIM (3 ESTs); MT_DSIL (2 ESTs); MT_DSLC (2 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_MGHG (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_LEAF_PHOMA (1 ESTs); MT_DLEAF (1 ESTs); |
Sequence | GCCAATCGTCTAGAAAAGAGAAGGTTCCATCGGAACAATTATTTATTGCTATTTCAGGAT |
EST members of Unigene | CA923094 CX539380 CX539062 CX539018 CX527776 CX527349 CX527202 CX526099 CX524791 CX524422 EV259965 DW018818 BF005174 BF004923 AJ499836 AJ500930 AJ500471 CA990632 CA990500 BI312230 BI311541 BI311299 BI311206 BQ149123 BQ149115 BQ148761 BQ148423 BQ148063 BQ147869 BQ147101 BQ146400 BQ146253 BI271534 BQ141421 BF636978 BF521084 BF520546 BI264833 BI264608 BI264605 BI264232 BI263910 BI263821 BI263400 BI263374 BI262915 BI262909 BG458160 BG458017 BG457994 BG457990 BG457884 BG457514 BG457266 BG457010 BG456553 BG456532 BG456459 BG456222 BG456145 BG456040 BG455926 BG455748 BG455673 BG455621 BG455184 BG455088 BE324780 BE323531 BE324621 BE324471 BE324094 BE324927 BE324510 BF639090 BF639032 BF638881 BF638876 BF638856 BF638782 BF638771 BF638584 BF638578 BF638458 BF638435 BF638370 BF638293 BF638036 BF637929 BF637851 BF637794 BF637775 BF637691 BF637572 BF637503 BF637488 BF637473 BF637336 BE324874 BE324849 BE942074 BE322676 BF641338 BF641505 BF640861 GE350141 GE351639 GE350209 GE349057 GE349002 GE347210 GE349721 GE345160 GE343919 GE344671 GE343860 GE345233 EX531029 EX528509 ES612889 ES612806 ES611019 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 3.A.2 H+- or Na+-translocating F-type, V-type and A-type ATPase superfamily F-ATPase |
Probeset |
Mtr.14054.1.S1_s_at, Mtr.14056.1.S1_s_at, Mtr.20283.1.S1_s_at, Mtr.20284.1.S1_s_at
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |