| Detail of Probeset Mtr.14573.1.S1_x_at in Chip AffyMedicago | |
| Probeset ID | Mtr.14573.1.S1_x_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|753.m00001 /FEA=mRNA /DEF=SKP1 component AC123571.7.11 5874 7366 mth1-14n3 01/13/05 |
| Mapped public sequence ID | IMGAG|753.m00001 |
| Gene Ontology | GO:0004842 GO:0005515 GO:0005654 GO:0005829 GO:0019005 GO:0051437 GO:0030261 GO:0042023 GO:0045931 GO:0051298 |
| KEGG | K03094 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40502 TCMT40486 BQ153855 DY617371 |
| Target sequence | ccttctgaggatgagattaagagctgggatggtgagtttgttaaggttgaccaggctacg |