Detail of EST/Unigene TCMS40502 |
Acc. | TCMS40502 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | SKP1-like protein 1B OS=Arabidopsis thaliana E-value=2e-63; SKP1-like protein 1A OS=Arabidopsis thaliana E-value=2e-61; SKP1-like protein 4 OS=Arabidopsis thaliana E-value=2e-56; SKP1-like protein 3 OS=Arabidopsis thaliana E-value=3e-53; SKP1-like protein 11 OS=Arabidopsis thaliana E-value=1e-51; |
Length | 840 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (3 ESTs); MS_TRI2 (1 ESTs); MS_CDS (1 ESTs); |
Sequence | GGGACACGTTCATTCAGTTTCTCTATTTTCCGATTCAGAAAAAATTAGGGTTTTGATTTG |
EST members of Unigene | CO517166 CO513371 CO513276 EX522991 AF135596 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03094 S-phase kinase-associated protein 1; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K03094 S-phase kinase-associated protein 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03094 S-phase kinase-associated protein 1 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.2971.1.S1_at, Mtr.14573.1.S1_x_at
|
Corresponding NCBI Gene | 834224 |
Trichome-related Gene from Literature | N/A |