| Detail of Probeset Mtr.16956.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.16956.1.S1_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|890.m00022 /FEA=mRNA /DEF=SAM (and some other nucleotide) binding motif; O-methyltransferase, family 3 AC136449.21.211 91811 90580 mth2-11k13 01/13/05 |
| Mapped public sequence ID | IMGAG|890.m00022 |
| Gene Ontology | GO:0008150 GO:0008152 GO:0008171 GO:0045335 GO:0005575 |
| KEGG | K00588 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | MSU20736 EX522409 TCMT41051 |
| Target sequence | gaggtcacagcaaaacacccatggaacatcatgacaacctctgcagatgaaggacaattt |