| Detail of Probeset Mtr.19657.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.19657.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|1190.m00006 /FEA=mRNA /DEF=Ras GTPase; GTP-binding nuclear protein Ran; Small GTP-binding protein domain; ADP-ribosylation factor; Ras small GTPase, Ras type; Ras small GTPase, Rab type; Ras small GTPase, Rho type AC148176.11.51 31177 33576 mth2-3j |
| Mapped public sequence ID | IMGAG|1190.m00006 |
| Gene Ontology | GO:0000467 GO:0003924 GO:0005634 GO:0005737 GO:0006913 GO:0006997 GO:0005515 GO:0005525 GO:0005829 GO:0007346 GO:0031291 |
| KEGG | K01199 K07936 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40711 EX523451 TCMT40146 AL374585 TCMT40499 AJ845703 |
| Target sequence | gaatgagcttctccaagctgctaatcaaccccttcctgatgacgatgatg |