| Detail of EST/Unigene AJ845703 |
| Acc. | AJ845703 |
| Internal Acc. | AJ845703 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Pisum sativum E-value=3e-47; Glucan endo-1,3-beta-glucosidase, basic isoform OS=Phaseolus vulgaris E-value=2e-45; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Hevea brasiliensis E-value=2e-32; Lichenase OS=Nicotiana plumbaginifolia E-value=8e-32; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Nicotiana plumbaginifolia E-value=4e-30; |
| Length | 414 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtSNF (1 ESTs); |
| Sequence | ATATACCAAGTATCCAATGAAAGGATCTAGGTATGACCTAACATCATTTCTAAAAGAACC |
| EST members of Unigene | AJ845703 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.19657.1.S1_s_at
|
| Corresponding NCBI Gene | 827320 |
| Trichome-related Gene from Literature | N/A |