| Detail of Probeset Mtr.25732.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.25732.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
1451.m00036 /FEA=mRNA /DEF=AC147482.2 26480 26845 mth2-93e11 homologue to UP|Q8LK53 (Q8LK53) Ribosomal protein small subunit 28 |
| Mapped public sequence ID |
1451.m00036 |
| Gene Ontology |
GO:0003723 GO:0003735 GO:0005811 GO:0006412 GO:0022627 GO:0005515 GO:0005829 GO:0006364 GO:0006414 GO:0042274 GO:0004565 GO:0005990 |
| KEGG |
K02979 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT41950 BQ159267
AL375183 |
| Target sequence |
cagattaagcatgctgtggttgtgaaagttatgggtcgtacgggatccagaggacaagtc
actcaggttagagtgaagtttttggacgatcagaaccgtcacatcatgaggaatgtcaag
ggaccagttagggagggagacatccttaccctccttgagtccgagagagaag |