Detail of Probeset Mtr.25732.1.S1_s_at in Chip AffyMedicago |
Probeset ID |
Mtr.25732.1.S1_s_at |
Species |
Medicago truncatula |
Annotation |
1451.m00036 /FEA=mRNA /DEF=AC147482.2 26480 26845 mth2-93e11 homologue to UP|Q8LK53 (Q8LK53) Ribosomal protein small subunit 28 |
Mapped public sequence ID |
1451.m00036 |
Gene Ontology |
GO:0003723 GO:0003735 GO:0005811 GO:0006412 GO:0022627 GO:0005515 GO:0005829 GO:0006364 GO:0006414 GO:0042274 GO:0004565 GO:0005990 |
KEGG |
K02979 |
Transporter |
|
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
TCMT41950 BQ159267
AL375183 |
Target sequence |
cagattaagcatgctgtggttgtgaaagttatgggtcgtacgggatccagaggacaagtc
actcaggttagagtgaagtttttggacgatcagaaccgtcacatcatgaggaatgtcaag
ggaccagttagggagggagacatccttaccctccttgagtccgagagagaag |