Detail of EST/Unigene TCMT41950 |
Acc. | TCMT41950 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 40S ribosomal protein S28 OS=Zea mays E-value=2e-18; 40S ribosomal protein S28-1 OS=Arabidopsis thaliana E-value=7e-18; 40S ribosomal protein S28-2 OS=Arabidopsis thaliana E-value=2e-17; 40S ribosomal protein S28 OS=Ictalurus punctatus E-value=1e-13; 40S ribosomal protein S28 OS=Danio rerio E-value=1e-13; |
Length | 814 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBB_NOD (7 ESTs); MT_GESD (5 ESTs); MT_NOD_GVN (3 ESTs); MT_ROOTPHOS (3 ESTs); MT_JCVI-MT2 (3 ESTs); MT_DLEAF (3 ESTs); MtBA (2 ESTs); MT_DFLOWER (2 ESTs); MT_DSIL (2 ESTs); MT_JCVI-MT1 (1 ESTs); MT_PhoLEAF (1 ESTs); MT_NOD_GVSN (1 ESTs); MT_SROOT_KV1 (1 ESTs); MT_MGHG (1 ESTs); MTAMP (1 ESTs); MT_Drought (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_NOD_NOLLY (1 ESTs); MT_GPOD (1 ESTs); MT_ECELL (1 ESTs); MT_SROOT_KV0 (1 ESTs); |
Sequence | CTATTACGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGC |
EST members of Unigene | DY617451 AL380581 AL380580 AL377106 AL375184 AL374633 AL373826 AL373825 BF651127 EV256283 BE999622 BE124912 BE124570 AW574182 AW329559 AW329355 AW329043 AJ501248 CA990645 CA918489 BI312332 BI312327 BI310157 BQ148342 BQ146305 BQ151171 BE315887 BF636677 CA917123 AW776457 AW775917 AW225611 BF637402 BE202846 AL368302 AL368301 BE941251 BE248195 EY476186 GE352280 GE347945 GE347553 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02979 small subunit ribosomal protein S28e |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.25732.1.S1_s_at
|
Corresponding NCBI Gene | 831692 |
Trichome-related Gene from Literature | N/A |