| Detail of Probeset Mtr.31920.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.31920.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | AL385676 /FEA=mRNA /DEF=similar to UP|Q9ZRD3 (Q9ZRD3) NTGP1, partial (58%) |
| Mapped public sequence ID | AL385676 |
| Gene Ontology | GO:0000324 GO:0005484 GO:0005625 GO:0005634 GO:0005739 GO:0005768 GO:0005794 GO:0005829 GO:0006891 GO:0006892 GO:0006906 GO:0016020 GO:0016192 GO:0016409 GO:0044431 GO:0000011 |
| KEGG | K08516 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40846 AL385676 TCMT43235 |
| Target sequence | taccgactgcgtgcgaatcacaacaaagaacaaaaaaacacaaagccgcgaaataatata |