Detail of Probeset Mtr.33669.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.33669.1.S1_at
Species Medicago truncatula
Annotation BI263359 /FEA=mRNA /DEF=similar to UP|Q874B1 (Q874B1) Manganese superoxide dismutase, partial (88%)
Mapped public sequence ID BI263359
Gene Ontology GO:0000302 GO:0000303 GO:0001306 GO:0001315 GO:0001666 GO:0001836 GO:0001889 GO:0003032 GO:0003069 GO:0004784 GO:0005625 GO:0005737 GO:0005739 GO:0005743 GO:0006302 GO:0006357 GO:0006749 GO:0006801 GO:0006915 GO:0006916 GO:0006950 GO:0006979 GO:0007005 GO:0007507 GO:0007568 GO:0007605 GO:0007626 GO:0008217 GO:0009791 GO:0010260 GO:0010332 GO:0014823 GO:0019430 GO:0019825 GO:0022904 GO:0030097 GO:0031667 GO:0032364 GO:0042311 GO:0042493 GO:0042542 GO:0042554 GO:0042743 GO:0043066 GO:0043524 GO:0045429 GO:0045599 GO:0048147 GO:0048666 GO:0048678 GO:0048773 GO:0050665 GO:0050790 GO:0051881 GO:0055072 GO:0055093
KEGG K04564
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database BI263359  
Target sequence gactatggcgctcttgagcctcacatctccggccagatcatggagcttcaccactccaag
caccaccagacctacgtcaccggcttcaacaacgctaccgacgccctcgctgaggcccag
cacaagaacgacgccaaggccgctgctgcccaagctcctctgatcaacttccacggcggt
ggtcatgttaaccactctctcttctgggagaatcttgctcccaatggcaagggcggtggt
ggtgagcctgagggt