| Detail of Probeset Mtr.34988.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.34988.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | CX529827 /FEA=mRNA /DEF=similar to UP|Q8W2E3 (Q8W2E3) 3-hydroxy-3-methylglutaryl coenzyme A, partial (6%) |
| Mapped public sequence ID | CX529827 |
| Gene Ontology | GO:0004420 GO:0005792 GO:0006695 GO:0007517 GO:0008542 GO:0009790 GO:0043407 GO:0016126 GO:0042493 |
| KEGG | K00021 |
| Transporter | 2.A.6 2.A.6.6 2.A.6.6.5 |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | EV262675 TCMT52641 CX529827 |
| Target sequence | gaaaaaatatggacgctcgccggagacttaaatctcttcctccacgttctcccgccggcg |