Detail of Probeset Mtr.37441.1.S1_s_at in Chip AffyMedicago
Probeset ID Mtr.37441.1.S1_s_at
Species Medicago truncatula
Annotation TC100661 /FEA=mRNA /DEF=homologue to UP|ADH1_TRIRP (P13603) Alcohol dehydrogenase 1 , partial (61%)
Mapped public sequence ID TC100661
Gene Ontology GO:0001523 GO:0003016 GO:0003960 GO:0004022 GO:0004024 GO:0004032 GO:0004745 GO:0005503 GO:0005625 GO:0005739 GO:0006067 GO:0006069 GO:0006081 GO:0008270 GO:0018119 GO:0019115 GO:0019841 GO:0032496 GO:0035276 GO:0042375 GO:0042572 GO:0042803 GO:0045777 GO:0046164 GO:0046294 GO:0051287 GO:0051409 GO:0051903 GO:0009055
KEGG K00001
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database TCMT46400  TCMT46401  
Target sequence tttcgtcggtacatctacattcagcgagtacact