Detail of EST/Unigene TCMT46401 |
Acc. | TCMT46401 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Alcohol dehydrogenase 1 OS=Pisum sativum E-value=0; Alcohol dehydrogenase 1 OS=Trifolium repens E-value=0; Alcohol dehydrogenase 1 OS=Petunia hybrida E-value=0; Alcohol dehydrogenase OS=Malus domestica E-value=0; Alcohol dehydrogenase class-P OS=Arabidopsis thaliana E-value=0; |
Length | 1269 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL (8 ESTs); MT_NOD_ROOT (5 ESTs); MT_NOD_GVN (3 ESTs); MT_IROOT_DSIR (2 ESTs); MT_PhoLEAF (1 ESTs); MT_HOGA (1 ESTs); MT_NOD_GVSN (1 ESTs); MT_GESD (1 ESTs); MT_DLEAF (1 ESTs); MTPOSE (1 ESTs); |
Sequence | ACGAGGCGAGTACTAGTAGCATTGCAAAGCAACAAACAACTTACTACTCACCCATTCGAT |
EST members of Unigene | AW560618 AW560617 BF650629 BF650617 BF647829 BF647630 BF647267 BF645349 BF644274 BF643479 BE997740 BG583249 BG581597 BG580711 BG448760 AW686681 AW685706 AW685559 AW684056 BI311583 BG452487 AJ498491 BF639021 BG647657 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00624 1- and 2-Methylnaphthalene degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00641 3-Chloroacrylic acid degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00001 alcohol dehydrogenase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00001 alcohol dehydrogenase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 |
EC | 1.1.1.1 1.1.1.284 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.37441.1.S1_s_at
|
Corresponding NCBI Gene | 844047 |
Trichome-related Gene from Literature | N/A |