| Detail of Probeset Mtr.37461.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.37461.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | TC100696 /FEA=mRNA /DEF=similar to UP|Q9LKJ4 (Q9LKJ4) Alanine aminotransferase , partial (71%) |
| Mapped public sequence ID | TC100696 |
| Gene Ontology | GO:0004021 GO:0005575 GO:0009058 GO:0016769 GO:0005634 GO:0005737 GO:0008150 GO:0008483 GO:0042493 GO:0005739 |
| KEGG | K00814 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT40696 DY615788 EV262780 |
| Target sequence | cacctggtaccatattatcttgatgaagcaactggttgggggctggaaatatctgaactc |