Detail of EST/Unigene EV262780 |
Acc. | EV262780 |
Internal Acc. | MTYEZ73TF |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Alanine aminotransferase 1, mitochondrial OS=Arabidopsis thaliana E-value=2e-92; Alanine aminotransferase 2, mitochondrial OS=Arabidopsis thaliana E-value=8e-91; Alanine aminotransferase 2 OS=Panicum miliaceum E-value=8e-86; Alanine aminotransferase 2 OS=Hordeum vulgare E-value=2e-83; Probable alanine aminotransferase, mitochondrial OS=Dictyostelium discoideum E-value=1e-55; |
Length | 672 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1 (1 ESTs); |
Sequence | GATCTTTCTCACAATATATAAACCCAAGCACACCACACAATGCGGAAATCCGCTGCAGAT |
EST members of Unigene | EV262780 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00814 alanine transaminase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K00814 alanine transaminase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K00814 alanine transaminase |
EC | 2.6.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.36223.1.S1_s_at, Mtr.37461.1.S1_s_at
|
Corresponding NCBI Gene | 838301 |
Trichome-related Gene from Literature | N/A |