| Detail of Probeset Mtr.40196.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.40196.1.S1_at |
| Species | Medicago truncatula |
| Annotation | TC106732 /FEA=mRNA /DEF=homologue to UP|Q93WA5 (Q93WA5) Ribosomal protein L32, complete |
| Mapped public sequence ID | TC106732 |
| Gene Ontology | GO:0003735 GO:0006412 GO:0022625 GO:0000022 GO:0005840 GO:0007052 |
| KEGG | K02912 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT42183 BQ144097 BE942596 BQ153799 BQ145203 |
| Target sequence | cccaatattggatacggctcagacaagaagacccgccactatttgcctaatggattcaag |