| Detail of EST/Unigene TCMT42183 |
| Acc. | TCMT42183 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 60S ribosomal protein L32-1 OS=Arabidopsis thaliana E-value=3e-57; 60S ribosomal protein L32-2 OS=Arabidopsis thaliana E-value=2e-56; 60S ribosomal protein L32 OS=Spodoptera frugiperda E-value=2e-40; 60S ribosomal protein L32 OS=Rattus norvegicus E-value=4e-40; 60S ribosomal protein L32 OS=Sus scrofa E-value=4e-40; |
| Length | 660 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2 (10 ESTs); MT_SIRRA (8 ESTs); MtBB_NOD (7 ESTs); MT_DLEAF (6 ESTs); MT_Drought (5 ESTs); MHRP-root (4 ESTs); MT_FLOSEED_MTY (4 ESTs); MT_NOD_ROOT (3 ESTs); MTAMP (3 ESTs); MT_GESD (3 ESTs); MT_DFLOWER (3 ESTs); MT_GSEED (3 ESTs); MT_IROOT_DSIR (3 ESTs); MTPOSE (3 ESTs); MT_Shoots (3 ESTs); MT_JCVI-MT1 (3 ESTs); MT_HOGA (2 ESTs); MT_JCVI-MT3 (2 ESTs); MTFLOW (1 ESTs); MT_CDS (1 ESTs); MtRHE (1 ESTs); MT_NOD_NOLLY (1 ESTs); MT_MGHG (1 ESTs); MT_DROOT (1 ESTs); MT_PhoLEAF (1 ESTs); MT_ECELL (1 ESTs); MT_VILEAF (1 ESTs); |
| Sequence | GGGCCTCATTGCTTCTTACATATCTGAAGCAGCGATTCAAGCAGAGACAAGATGGCCGTT |
| EST members of Unigene | BT053260 DY617706 AL378730 AL376930 AL376929 AL376170 AL376169 AL373493 AL373492 AW687826 CX540087 CX538890 CX536393 AW560076 AW560075 AW267779 CX528557 CX526108 CX526087 BF649260 EV259721 EV257773 EV255458 DW018774 DW017707 DW017175 DW017089 AW685466 AW684909 AW684167 AJ504378 AJ501949 AJ501705 CA990020 BI311605 BI311456 BG588373 BE240561 BE240164 BE240163 BQ148981 BQ147876 BI270643 BG454251 BG453621 BG452932 AW683416 AW683709 BF637017 AJ498758 AJ498590 AJ498242 BG457596 BQ156397 BQ156355 BQ156053 BQ155794 BQ155570 BQ154187 BQ154013 BI268934 CX522916 CB893693 CB893000 AJ497222 AA661018 BE941615 BG451683 BG451122 BE248419 BF633896 BF633117 EY478340 EY474302 GE352719 GE350609 GE351830 GE348649 GE348637 GE347431 GE348447 GE345690 GE343424 GE343408 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02912 large subunit ribosomal protein L32e |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.40196.1.S1_at
|
| Corresponding NCBI Gene | 827535 |
| Trichome-related Gene from Literature | N/A |