Detail of Probeset Mtr.41563.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.41563.1.S1_at
Species Medicago truncatula
Annotation TC109632 /FEA=mRNA /DEF=similar to GB|AAM11573.1|20136190|AF480944 ring finger E3 ligase SINAT5 {Arabidopsis thaliana;} , partial (42%)
Mapped public sequence ID TC109632
Gene Ontology GO:0004842 GO:0005515 GO:0005769 GO:0007141 GO:0007283 GO:0008021 GO:0009791 GO:0040014 GO:0042787
KEGG K04506 K08742
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database TCMT60169  
Target sequence atcaaatgttcttctgatcaattttatcgcttcagggccgctggggatttctcttgctag
catggcattgagtaat