Detail of Probeset Mtr.41563.1.S1_at in Chip AffyMedicago |
Probeset ID |
Mtr.41563.1.S1_at |
Species |
Medicago truncatula |
Annotation |
TC109632 /FEA=mRNA /DEF=similar to GB|AAM11573.1|20136190|AF480944 ring finger E3 ligase SINAT5 {Arabidopsis thaliana;} , partial (42%) |
Mapped public sequence ID |
TC109632 |
Gene Ontology |
GO:0004842 GO:0005515 GO:0005769 GO:0007141 GO:0007283 GO:0008021 GO:0009791 GO:0040014 GO:0042787 |
KEGG |
K04506 K08742 |
Transporter |
|
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
TCMT60169 |
Target sequence |
atcaaatgttcttctgatcaattttatcgcttcagggccgctggggatttctcttgctag
catggcattgagtaat |