| Detail of Probeset Mtr.47897.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.47897.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
1617.m00042 /FEA=mRNA /DEF=AC136505.26 48279 48734 mth2-24f15 homologue to UP|Q7X8V5 (Q7X8V5) OSJNBb0118P14.12 protein |
| Mapped public sequence ID |
1617.m00042 |
| Gene Ontology |
GO:0003987 GO:0005515 GO:0005634 GO:0005730 GO:0005737 GO:0005829 GO:0008610 GO:0016208 GO:0005575 GO:0006085 |
| KEGG |
K01895 |
| Transporter |
9.B.17.1.4 9.B.17.1.6 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT43972 |
| Target sequence |
ttgcagcacctgacaaaatccattgggcacctggcctcccaaaaacaaggagcggaaaga
taatgagaagaattcttagaaaaattgcttctaggcagctagatgaacttggagatacaa
gtacccttgcagagccaaacgtggtcactgaacttattgaacttgctgattcatg |
