Detail of EST/Unigene TCMT43972 |
Acc. | TCMT43972 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Acetate--CoA ligase ACS, chloroplastic/glyoxysomal OS=Arabidopsis thaliana E-value=0; Acetyl-coenzyme A synthetase OS=Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2) E-value=0; Acetyl-coenzyme A synthetase OS=Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB) E-value=0; Acetyl-coenzyme A synthetase OS=Xanthomonas oryzae pv. oryzae (strain MAFF 311018) E-value=0; Acetyl-coenzyme A synthetase 2 OS=Pseudomonas aeruginosa (strain ATCC 15692 / PAO1 / 1C / PRS 101 / LMG 12228) E-value=0; |
Length | 1282 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE (1 ESTs); MtBC_GLOMUS (1 ESTs); MTAMP (1 ESTs); MT_GESD (1 ESTs); MT_GPOD (1 ESTs); MT_JCVI-MT2 (1 ESTs); |
Sequence | GCATTTAAGTATGCTATTTGACTACAAGCCATCTGACATCTACTGGTGTACAGCTGATTG |
EST members of Unigene | CA920909 AL385349 AJ503946 BI310456 CA917868 GE343680 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01895 acetyl-CoA synthetase |
EC | 6.2.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.37998.1.S1_at, Mtr.47897.1.S1_s_at, Mtr.47898.1.S1_s_at
|
Corresponding NCBI Gene | 833655 |
Trichome-related Gene from Literature | N/A |