| Detail of Probeset Mtr.50511.1.S1_x_at in Chip AffyMedicago | |
| Probeset ID | Mtr.50511.1.S1_x_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|966.m00026 /FEA=mRNA /DEF=Pre-mRNA splicing protein; Thioredoxin domain 2 AC140026.11.261 104134 102626 mth2-36j24 01/13/05 |
| Mapped public sequence ID | IMGAG|966.m00026 |
| Gene Ontology | GO:0000245 GO:0003674 GO:0005634 GO:0005681 GO:0005682 GO:0005737 GO:0007067 GO:0008150 GO:0031202 |
| KEGG | K24348 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | CO515730 EX523800 TCMT42104 |
| Target sequence | acttgcattcgggatgggctgttgatcaggcaatccttgctgaggaggaacgtctcgttg |