| Detail of EST/Unigene TCMT42104 |
| Acc. | TCMT42104 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin-like protein 4A OS=Mus musculus E-value=2e-71; Thioredoxin-like protein 4A OS=Homo sapiens E-value=2e-71; Mitosis protein dim1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=5e-61; Spliceosomal protein DIB1 OS=Ashbya gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056) E-value=1e-50; Thioredoxin-like protein 4A homolog OS=Dictyostelium discoideum E-value=1e-47; |
| Length | 788 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS (4 ESTs); MT_JCVI-MT2 (4 ESTs); MT_JAS_ROOR (3 ESTs); MT_JCVI-MT1 (3 ESTs); MT_MGHG (2 ESTs); MT_DSTEM2 (2 ESTs); MTAMP (2 ESTs); MT_GESD (1 ESTs); MT_PhoLEAF (1 ESTs); MT_CDS (1 ESTs); MT_HOGA (1 ESTs); MT_SROOT_KV1 (1 ESTs); MtBB_NOD (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_ECELL (1 ESTs); MT_FLOSEED_MTY (1 ESTs); |
| Sequence | GACATCACCTCTATCTATCTATCTCACCACACCCGCTCTATTGTTGTTGAATTGAAGGTG |
| EST members of Unigene | BT050596 AL386776 AL386775 AL386612 AL386611 AL379466 AW696041 AW694525 BG448010 EV258811 EV256341 EV255034 DW017094 AJ503460 AJ502343 BI312038 BG456484 CX533556 CX532476 CX529545 CB893067 BF003791 BE943371 BE942629 EY478274 GE352701 GE349005 GE348427 GE343863 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1415.1.S1_at, Mtr.50511.1.S1_at, Mtr.50511.1.S1_x_at
|
| Corresponding NCBI Gene | 830725 |
| Trichome-related Gene from Literature | N/A |