| Detail of Probeset Mtr.51061.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.51061.1.S1_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|830.m00013 /FEA=mRNA /DEF=Cytochrome P450; E-class P450, group I AC130800.18.131 66825 67094 mth2-36b7 01/13/05 |
| Mapped public sequence ID | IMGAG|830.m00013 |
| Gene Ontology | GO:0005789 GO:0005792 GO:0006725 GO:0006778 GO:0009055 GO:0009404 GO:0009791 GO:0010468 GO:0017144 GO:0018894 GO:0019825 GO:0030324 GO:0032451 GO:0045333 GO:0050665 GO:0006694 GO:0016020 |
| KEGG | K00517 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | CA919529 |
| Target sequence | tggaatttcaattggcagcttccggagggtggcc |