| Detail of EST/Unigene CA919529 |
| Acc. | CA919529 |
| Internal Acc. | EST637247 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 89A9 OS=Arabidopsis thaliana E-value=2e-50; Cytochrome P450 89A2 OS=Arabidopsis thaliana E-value=6e-50; Cytochrome P450 77A1 (Fragment) OS=Solanum melongena E-value=8e-33; Cytochrome P450 77A2 OS=Solanum melongena E-value=4e-30; Cytochrome P450 77A4 OS=Arabidopsis thaliana E-value=1e-29; |
| Length | 802 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTUS_MIXTISSUE (1 ESTs); |
| Sequence | ATACATTGAAAGTATCTTGACTTACAAGAATGACAGACATGTTTTATTTTATACAAGAAA |
| EST members of Unigene | CA919529 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K01832 cytochrome P450, family 5, subfamily A (thromboxane-A synthase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Biosynthesis of Secondary Metabolites > ko00232 Caffeine metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochro |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.51061.1.S1_at, Mtr.51061.1.S1_x_at
|
| Corresponding NCBI Gene | 842803 |
| Trichome-related Gene from Literature | N/A |