Detail of EST/Unigene AA660501 |
Acc. | AA660501 |
Internal Acc. | 00387 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 4 OS=Arabidopsis thaliana E-value=1e-21; Glucan endo-1,3-beta-glucosidase 1 OS=Arabidopsis thaliana E-value=3e-19; Glucan endo-1,3-beta-glucosidase 12 OS=Arabidopsis thaliana E-value=2e-18; Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=1e-17; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=1e-15; |
Length | 581 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtRHE (1 ESTs); |
Sequence | GCAGACCACTGACTCTGATTTGCAGGATGCCTTGAATTGGGCTTGTGGGAAAGGAGGTGC |
EST members of Unigene | AA660501 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.4281.1.S1_at
|
Corresponding NCBI Gene | 833551 |
Trichome-related Gene from Literature | N/A |