Detail of EST/Unigene AI974405 |
Acc. | AI974405 |
Internal Acc. | T110350e |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Calcium-transporting ATPase 8, plasma membrane-type OS=Arabidopsis thaliana E-value=7e-28; Calcium-transporting ATPase 10, plasma membrane-type OS=Arabidopsis thaliana E-value=1e-25; Calcium-transporting ATPase 9, plasma membrane-type OS=Arabidopsis thaliana E-value=8e-24; Putative calcium-transporting ATPase 13, plasma membrane-type OS=Arabidopsis thaliana E-value=3e-14; Calcium-transporting ATPase 12, plasma membrane-type OS=Arabidopsis thaliana E-value=6e-13; |
Length | 332 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV0 (1 ESTs); |
Sequence | CATTTCAGAAGATACTGGTGAAGAAACACCTTTGCAGGTCCGCTTGAATGGCGTAGCCAC |
EST members of Unigene | AI974405 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 3.A.3 P-type ATPase superfamily P-ATPase |
Probeset |
Mtr.31084.1.S1_at
|
Corresponding NCBI Gene | 835815 |
Trichome-related Gene from Literature | N/A |