| Detail of EST/Unigene AI974405 |
| Acc. | AI974405 |
| Internal Acc. | T110350e |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Calcium-transporting ATPase 8, plasma membrane-type OS=Arabidopsis thaliana E-value=7e-28; Calcium-transporting ATPase 10, plasma membrane-type OS=Arabidopsis thaliana E-value=1e-25; Calcium-transporting ATPase 9, plasma membrane-type OS=Arabidopsis thaliana E-value=8e-24; Putative calcium-transporting ATPase 13, plasma membrane-type OS=Arabidopsis thaliana E-value=3e-14; Calcium-transporting ATPase 12, plasma membrane-type OS=Arabidopsis thaliana E-value=6e-13; |
| Length | 332 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV0 (1 ESTs); |
| Sequence | CATTTCAGAAGATACTGGTGAAGAAACACCTTTGCAGGTCCGCTTGAATGGCGTAGCCAC |
| EST members of Unigene | AI974405 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 3.A.3 P-type ATPase superfamily P-ATPase |
| Probeset |
Mtr.31084.1.S1_at
|
| Corresponding NCBI Gene | 835815 |
| Trichome-related Gene from Literature | N/A |