| Detail of EST/Unigene AJ498987 |
| Acc. | AJ498987 |
| Internal Acc. | AJ498987 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable phytol kinase 3, chloroplastic OS=Glycine max E-value=3e-63; Probable phytol kinase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-56; Probable phytol kinase 2, chloroplastic OS=Arabidopsis thaliana E-value=3e-52; Probable phytol kinase 1, chloroplastic OS=Glycine max E-value=1e-32; Phytol kinase 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-32; |
| Length | 595 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTPOSE (1 ESTs); |
| Sequence | GTGAAATCATTGAGCAGATTTGGAGATTATAGGGTGCTTCTTATGGGATCACTGTATTAT |
| EST members of Unigene | AJ498987 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.40727.1.S1_at
|
| Corresponding NCBI Gene | 835969 |
| Trichome-related Gene from Literature | N/A |