| Detail of EST/Unigene AJ499077 |
| Acc. | AJ499077 |
| Internal Acc. | AJ499077 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutamate receptor 3.4 OS=Arabidopsis thaliana E-value=1e-58; Glutamate receptor 3.5 OS=Arabidopsis thaliana E-value=3e-54; Glutamate receptor 3.3 OS=Arabidopsis thaliana E-value=2e-49; Glutamate receptor 3.6 OS=Arabidopsis thaliana E-value=1e-45; Glutamate receptor 3.2 OS=Arabidopsis thaliana E-value=3e-44; |
| Length | 464 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTPOSE (1 ESTs); |
| Sequence | TGACAGCTTGATATCAGGTAATCAACCAATTGGAATTCAAGACGGGTCATTTGCAAGAAG |
| EST members of Unigene | AJ499077 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04020 Calcium signaling pathway > K05208 glutamate receptor, ionotropic, N-methyl D-aspartate 1; Environmental Information Processing > Signaling Molecules and Interaction > ko04080 Neuroactive ligand-receptor interaction > K05208 glutamate receptor, ionotropic, N-methyl D-aspartate 1; Environmental Information Processing > Signaling Molecules and Interaction > ko04080 Neuroactive ligand-receptor interaction > K05214 glutamate receptor, ionotropic, N-methyl-D-aspartate 3B |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC; 1.A.10 Glutamate-gated ion channel of neurotransmitter receptors GIC |
| Probeset |
Mtr.4374.1.S1_at
|
| Corresponding NCBI Gene | 839268 |
| Trichome-related Gene from Literature | N/A |