| Detail of EST/Unigene AJ499790 |
| Acc. | AJ499790 |
| Internal Acc. | AJ499790 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Dihydrodipicolinate synthase 2, chloroplastic OS=Arabidopsis thaliana E-value=9e-12; Dihydrodipicolinate synthase 1, chloroplastic OS=Arabidopsis thaliana E-value=9e-12; Dihydrodipicolinate synthase, chloroplastic OS=Nicotiana tabacum E-value=1e-10; Dihydrodipicolinate synthase, chloroplastic OS=Glycine max E-value=1e-09; Dihydrodipicolinate synthase 2, chloroplastic OS=Triticum aestivum E-value=2e-09; |
| Length | 282 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTGIM (1 ESTs); |
| Sequence | TCACATTATTCAATTCATGTATGAACTCAACACCTTACATTATTTGATTTTTGAAGTTTG |
| EST members of Unigene | AJ499790 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.36001.1.S1_at
|
| Corresponding NCBI Gene | 825259 |
| Trichome-related Gene from Literature | N/A |