Detail of EST/Unigene AJ499790 |
Acc. | AJ499790 |
Internal Acc. | AJ499790 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Dihydrodipicolinate synthase 2, chloroplastic OS=Arabidopsis thaliana E-value=9e-12; Dihydrodipicolinate synthase 1, chloroplastic OS=Arabidopsis thaliana E-value=9e-12; Dihydrodipicolinate synthase, chloroplastic OS=Nicotiana tabacum E-value=1e-10; Dihydrodipicolinate synthase, chloroplastic OS=Glycine max E-value=1e-09; Dihydrodipicolinate synthase 2, chloroplastic OS=Triticum aestivum E-value=2e-09; |
Length | 282 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTGIM (1 ESTs); |
Sequence | TCACATTATTCAATTCATGTATGAACTCAACACCTTACATTATTTGATTTTTGAAGTTTG |
EST members of Unigene | AJ499790 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.36001.1.S1_at
|
Corresponding NCBI Gene | 825259 |
Trichome-related Gene from Literature | N/A |