| Detail of EST/Unigene AJ500156 |
| Acc. | AJ500156 |
| Internal Acc. | AJ500156 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L14, chloroplastic OS=Cicer arietinum E-value=2e-14; 50S ribosomal protein L14, chloroplastic OS=Olimarabidopsis pumila E-value=6e-14; 50S ribosomal protein L14, chloroplastic OS=Nasturtium officinale E-value=6e-14; 50S ribosomal protein L14, chloroplastic OS=Lobularia maritima E-value=6e-14; 50S ribosomal protein L14, chloroplastic OS=Lepidium virginicum E-value=6e-14; |
| Length | 395 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTGIM (1 ESTs); |
| Sequence | GTACACAGAATATTTTTTTTACTTCAACTTTTTGACTGAAAGATAGAAAAAAATGATATG |
| EST members of Unigene | AJ500156 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.10405.1.S1_at
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |