Detail of EST/Unigene AJ500156 |
Acc. | AJ500156 |
Internal Acc. | AJ500156 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L14, chloroplastic OS=Cicer arietinum E-value=2e-14; 50S ribosomal protein L14, chloroplastic OS=Olimarabidopsis pumila E-value=6e-14; 50S ribosomal protein L14, chloroplastic OS=Nasturtium officinale E-value=6e-14; 50S ribosomal protein L14, chloroplastic OS=Lobularia maritima E-value=6e-14; 50S ribosomal protein L14, chloroplastic OS=Lepidium virginicum E-value=6e-14; |
Length | 395 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTGIM (1 ESTs); |
Sequence | GTACACAGAATATTTTTTTTACTTCAACTTTTTGACTGAAAGATAGAAAAAAATGATATG |
EST members of Unigene | AJ500156 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.10405.1.S1_at
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |