| Detail of EST/Unigene AJ500372 |
| Acc. | AJ500372 |
| Internal Acc. | AJ500372 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable serine/threonine-protein kinase DDB_G0279405 OS=Dictyostelium discoideum E-value=2e-07; Serine/threonine-protein kinase 1 OS=Heliothis zea nuclear polyhedrosis virus E-value=2e-06; Putative ribosomal protein S6 kinase alpha-2 OS=Caenorhabditis elegans E-value=5e-06; CBL-interacting serine/threonine-protein kinase 20 OS=Arabidopsis thaliana E-value=6e-06; |
| Length | 471 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTGIM (1 ESTs); |
| Sequence | TACAATGACATTAAAATAGCTAACTTGATATTTTGTGAATTTCGCATAGTAAATATTAAT |
| EST members of Unigene | AJ500372 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04456 RAC serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04630 Jak-STAT signaling pathway > K04456 RAC serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04456 RAC serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04456 RAC serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04456 RAC serine/threonine-protein kinase |
| EC | 2.7.11.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.7607.1.S1_at
|
| Corresponding NCBI Gene | 834622 |
| Trichome-related Gene from Literature | N/A |