Detail of EST/Unigene AJ500404 |
Acc. | AJ500404 |
Internal Acc. | AJ500404 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable replication factor C subunit 3 OS=Dictyostelium discoideum E-value=2e-17; Replication factor C subunit 3 OS=Mus musculus E-value=1e-15; Replication factor C subunit 3 OS=Bos taurus E-value=2e-15; Replication factor C subunit 3 OS=Homo sapiens E-value=5e-15; Replication factor C subunit 5 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=3e-12; |
Length | 618 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTGIM (1 ESTs); |
Sequence | AACTGTCTAGGACTCTGCTCTGTGATTATATTTCTAGCAATATTCAAAATATCATCCTCC |
EST members of Unigene | AJ500404 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10756 replication factor C subunit 3/5; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10756 replication factor C subunit 3/5; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10756 replication factor C subunit 3/5 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.29654.1.S1_at
|
Corresponding NCBI Gene | 832836 |
Trichome-related Gene from Literature | N/A |