| Detail of EST/Unigene AJ500526 |
| Acc. | AJ500526 |
| Internal Acc. | AJ500526 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutamine synthetase OS=Suillus bovinus E-value=6e-60; Glutamine synthetase OS=Hebeloma cylindrosporum E-value=1e-59; Glutamine synthetase OS=Agaricus bisporus E-value=1e-59; Glutamine synthetase OS=Amanita muscaria E-value=1e-57; Glutamine synthetase OS=Yarrowia lipolytica (strain CLIB 122 / E 150) E-value=1e-56; |
| Length | 540 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTGIM (1 ESTs); |
| Sequence | ATATTATGTAAAAGGTGTGGAATTCTTCAACTATTTTTTTTATTAAATGTAGAAAAGTTA |
| EST members of Unigene | AJ500526 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01915 glutamine synthetase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01915 glutamine synthetase; Metabolism > Glycan Biosynthesis and Metabolism > ko00550 Peptidoglycan biosynthesis > K01915 glutamine synthetase; Environmental Information Processing > Signal Transduction > ko02020 Two-component system > K01915 glutamine synthetase |
| EC | 6.3.1.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.36015.1.S1_at
|
| Corresponding NCBI Gene | 833535 |
| Trichome-related Gene from Literature | N/A |