Detail of EST/Unigene AJ500526 |
Acc. | AJ500526 |
Internal Acc. | AJ500526 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamine synthetase OS=Suillus bovinus E-value=6e-60; Glutamine synthetase OS=Hebeloma cylindrosporum E-value=1e-59; Glutamine synthetase OS=Agaricus bisporus E-value=1e-59; Glutamine synthetase OS=Amanita muscaria E-value=1e-57; Glutamine synthetase OS=Yarrowia lipolytica (strain CLIB 122 / E 150) E-value=1e-56; |
Length | 540 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTGIM (1 ESTs); |
Sequence | ATATTATGTAAAAGGTGTGGAATTCTTCAACTATTTTTTTTATTAAATGTAGAAAAGTTA |
EST members of Unigene | AJ500526 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01915 glutamine synthetase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01915 glutamine synthetase; Metabolism > Glycan Biosynthesis and Metabolism > ko00550 Peptidoglycan biosynthesis > K01915 glutamine synthetase; Environmental Information Processing > Signal Transduction > ko02020 Two-component system > K01915 glutamine synthetase |
EC | 6.3.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.36015.1.S1_at
|
Corresponding NCBI Gene | 833535 |
Trichome-related Gene from Literature | N/A |